|
Vector Biolabs
plasmid construct paav cag dio tph2 antisense orientation wpre Plasmid Construct Paav Cag Dio Tph2 Antisense Orientation Wpre, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/antisense+plasmid/pmc12259259-232-1-9?v=Vector+Biolabs Average 95 stars, based on 1 article reviews
plasmid construct paav cag dio tph2 antisense orientation wpre - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
|
Addgene inc
nub rd trg2 sense gtcgttggcacaccgctagtccc g nub rd trg2 antisense aaaccgggactagcggtgtgc caa plasmids dna pcfd3 du6 3grna addgene rrid addgene 4941 0 j Nub Rd Trg2 Sense Gtcgttggcacaccgctagtccc G Nub Rd Trg2 Antisense Aaaccgggactagcggtgtgc Caa Plasmids Dna Pcfd3 Du6 3grna Addgene Rrid Addgene 4941 0 J, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/antisense+plasmid/pm41725553-846-84-92?v=Addgene+inc Average 96 stars, based on 1 article reviews
nub rd trg2 sense gtcgttggcacaccgctagtccc g nub rd trg2 antisense aaaccgggactagcggtgtgc caa plasmids dna pcfd3 du6 3grna addgene rrid addgene 4941 0 j - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Addgene inc
paper rrid bdsc 606410 13xlexaop sparc2 i gcamp8m p2a myr tdtomato vk05 Paper Rrid Bdsc 606410 13xlexaop Sparc2 I Gcamp8m P2a Myr Tdtomato Vk05, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/antisense+plasmid/pm40460825-766-50-61?v=Addgene+inc Average 93 stars, based on 1 article reviews
paper rrid bdsc 606410 13xlexaop sparc2 i gcamp8m p2a myr tdtomato vk05 - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
paper rrid bdsc 606408 13xlexaop sparc2 s gcamp8m vk05 Paper Rrid Bdsc 606408 13xlexaop Sparc2 S Gcamp8m Vk05, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/antisense+plasmid/pm40460825-766-46-61?v=Addgene+inc Average 93 stars, based on 1 article reviews
paper rrid bdsc 606408 13xlexaop sparc2 s gcamp8m vk05 - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
antisense oligonucleotides targeting mettl3 ![]() Antisense Oligonucleotides Targeting Mettl3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/antisense+plasmid/pmc12041481-239-8-33?v=Addgene+inc Average 95 stars, based on 1 article reviews
antisense oligonucleotides targeting mettl3 - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
|
Addgene inc
antisense oligonucleotides ![]() Antisense Oligonucleotides, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/antisense+plasmid/pmc11879308-41-29-34?v=Addgene+inc Average 93 stars, based on 1 article reviews
antisense oligonucleotides - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
antisense single guide rna ![]() Antisense Single Guide Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/antisense+plasmid/pmc11879057-84-6-14?v=Addgene+inc Average 96 stars, based on 1 article reviews
antisense single guide rna - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Addgene inc
antisense shrna oligonucleotides ![]() Antisense Shrna Oligonucleotides, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/antisense+plasmid/pmc11816722-97-9-18?v=Addgene+inc Average 96 stars, based on 1 article reviews
antisense shrna oligonucleotides - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Addgene inc
mature antisense aaaggtttgactcgtggag ![]() Mature Antisense Aaaggtttgactcgtggag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/antisense+plasmid/pmc12768500-31-18-22?v=Addgene+inc Average 98 stars, based on 1 article reviews
mature antisense aaaggtttgactcgtggag - by Bioz Stars,
2026-06
98/100 stars
|
Buy from Supplier |
Journal: Communications Biology
Article Title: IGF2BP3 recruits NUDT21 to regulate SPTBN1 alternative polyadenylation and drive ovarian cancer progression
doi: 10.1038/s42003-025-08097-6
Figure Lengend Snippet: A – C RT‒qPCR was used to detect the relative changes in the lengths of the target genes ICMT , ZEB1 , RNF213 and SPTBN1 in A2780, OVCAR3, and SKOV3 cells following NUDT21 ( A ), IGF2BP3 ( B ) and METTL3 ( C ) knockdown ( n = 4). D MeRIP‒qPCR of SPTBN1 m6A modification; RIP‒qPCR of SPTBN1 interaction with IGF2BP3 and NUDT21 ( n = 4). E and F RIP-qPCR was used to validate the relative fold change in SPTBN1 long and short isoform binding with NUDT21 in OVCAR3 cells (F) following IGF2BP3 knockdown ( E ) ( n = 4). G and H RIP-qPCR was used to validate the relative fold change in SPTBN1 long and short isoform binding with NUDT21 in OVCAR3 cells ( H ) following METTL3 knockdown ( G ) ( n = 3). I A dual-luciferase assay was performed on the 32nd intron of SPTBN1 with WT and m6A site mutations, which were both cotransfected with IGF2BP3 ( n = 4). J – L SPTBN1 long and short isoform protein levels were detected by Western blot in A2780, OVCAR3, and SKOV3 cells after NUDT21 ( J ), IGF2BP3 ( K ), and METTL3 ( L ) were knocked down. *P < 0.05, **P < 0.01, ***P < 0.001.
Article Snippet: To produce shRNAs for lentiviruses, complementary sense and
Techniques: Knockdown, Modification, Binding Assay, Luciferase, Western Blot